br Immunofluorescence based detection of

Immunofluorescence-based detection of proteins The cells were fixed with 4% paraformaldehyde for 20min at RT and washed two times with PBS. The immunofluorescence-based staining of proteins was carried out as described in Matz and Adjaye (2015). Primary Tunicamycin cost were used as follows: OCT4 (Santa Cruz, no. sc-5279), NANOG (R&D, no. AF1997), SOX2 (Santa Cruz, no. sc-17,320). Antibodies against SSEA4, TRA-1-60, and TRA-1-81 of the hESC characterization kit (Merck Millipore, no. SCR004) were used. In addition, antibodies were used against Smooth-Muscle-Actin (SMA) (Dako, no. M0851), α-Fetoprotein (AFP) (Sigma, no. WH0000174M1), β-Tubulin III (TUJ1) (Sigma, no. T8660). The secondary antibody was either conjugated to the dye Alexa Fluor 488 (Invitrogen, no. A11055) for green fluorescence or to Alexa Fluor 594 (Invitrogen, no. A21468) for red fluorescence. The nuclei of the cells were counterstained with 4′,6-Diamidin-2-phenylindol (DAPI, 200ng/ml, Invitrogen, no. H3570). The fluorophores on the secondary antibodies were visualized using a Zeiss, LSM 510 Meta confocal microscope with a connected camera for microscopy model AxioCam ICc3 and the software Axiovision 4.6.
Teratoma formation The in vivo differentiation experiments (teratoma formation) were performed by EPO Berlin GmbH (Germany, http://www.epo-berlin.de). Approximately 2×106 cells of the cell line were harvested by combined type IV collagenase treatment and 0.05% Trypsin/EDTA-treatment and washed. Cells were resuspended in 50μl PBS, then mixed with Matrigel (1:2) and immediately injected subcutaneously into NOD. Cg-rkdcscid Il2rgtm1Wjl/SzJ mice, commonly known as NOD scid gamma (NSG). Teratoma formation was carefully monitored and mice sacrificed 63d after injection. The teratomas were collected and processed using standard procedures for parafin embedding, then hematoxylin and eosin staining. Histological analysis was performed by a pathologist.
Karyotype analysis
DNA fingerprinting analysis Target regions of genomic DNA were amplified by polymerase chain reaction (PCR). The PCR was carried out for 35cycles and each cycle contained 96°C for 1min, 55°C for 1min, and 72°C for 1min. The following primer sequences (5′–3′) were used for DNA fingerprinting: D10S1214 forward ATTGCCCCAAAACTTTTTTG, reverse TTGAAGACCAGTCTGGGAAG; D17S1290 forward GCAACAGAGCAAGACTGTC, reverse GGAAACAGTTAAATGGCCAA; and D21S2055 forward AACAGAACCAATAGGCTATCTATC and reverse TACAGTAAATCACTTGGTAGGAGA.
RNA-based Microarray analysis Total RNA was isolated for each sample. For global gene expression analysis on an Illumina microarray platform, quality-checked total RNA was used. 500ng RNA for each sample was used as input for the amplification and biotin labeling reactions (Illumina TotalPrep RNA Amplification Kit, Ambion, Austin, TX, USA), which precede bead chip hybridizations. The cRNA synthesis, BeadChip hybridization, and scanning was performed by ATLAS Biolabs GmbH (http://www.atlasbiolabs.com). The dendrogram compares the expression data and the correlation values were calculated using the Gene Expression Module of the software GenomeStudio (Illumina).
Acknowledgments
Resource table
Resource details Fibroblasts were obtained from a 57-year old woman diagnosed with frontotemporal dementia and heterozygous for a P301L mutation in microtubule-associated protein tau (MAPT). iPSC-derived neurons from a patient with a P301L mutation were recently shown to undergo faster maturation and display altered mitochondrial transport and contorted processes compared with controls (Iovino et al. 2015). Reprogramming was performed by electroporation with three episomal plasmids containing hOCT4 with or without a short hairpin to TP53 (shp53), hSOX2 and hKLF4, and hL-MYC and hLIN28 (Okita et al. 2011). This method had previously been used to establish integration-free iPSC from an 18-year old healthy male (Rasmussen et al. 2014). Four weeks after reprogramming, an average of 20 colonies per 1×105 fibroblasts (0.02%) emerged with the inclusion of shp53, whereas, no colonies were observed without shp53. Integration analysis with plasmid-specific primers showed that hOCT4, hSOX2 and hLIN28, present on each of the three plasmids, had not integrated into the genome (Fig. 1A) and sequencing confirmed the presence of a c.902C>T substitution in one of the alleles of exon 10 in the MAPT gene corresponding to a P301L mutation (Fig. 1B). Pluripotency analysis showed that transcription from the endogenous pluripotency genes NANOG, POU5F1 (OCT4), TDGF1, DNMT3B, GABRB3 and GDF3 were between 100 and 10,000 times upregulated compared with fibroblasts (Fig. 1C) and immunocytochemical (ICC) analysis demonstrated the presence of the pluripotency markers OCT4, NANOG, TRA1-60, TRA1-81, SSEA3 and SSEA4 at the protein level (Fig. 1D). Finally, in vitro differentiation followed by ICC analysis with the mesodermal marker smooth muscle actin (SMA), the endodermal marker alpha-feto protein (AFP) and the ectodermal marker beta-III-Tubulin (TUJI) demonstrated the differentiation potential into all three germ layers (Fig. 1E).